Preview

Проблемы особо опасных инфекций

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
№ 3 (2016) Активатор плазминогена – многофункциональный белок возбудителя чумы Аннотация  PDF (Rus)  похожие документы
Л. М. Куклева, А. В. Бойко
"... Yersinia pestis plasminogen activator, a surface protease (Pla) is encoded by species-specific ..."
 
№ 4(98) Гидролизующая способность протеазы ферментного комплекса холерного вибриона – протеовибрина по отношению к белковым субстратам Аннотация  PDF (Rus)  похожие документы
И. А. Кузьмиченко, М. Н. Киреев, О. В. Громова, В. С. Бронникова, С. А. Нижегородцев
"... of M41 production strain is shown. Proteovibrin protease doesn't yield to commercial trypsin ..."
 
№ 2(112) Формирование внеклеточных ловушек - эффективный механизм защиты организма от патогена Аннотация  PDF (Rus)  похожие документы
А. Л. Кравцов
 
№ 3 (2014) Мембранный белок OmpT холерного вибриона как возможный представитель омптинов семейства Vibrionaceae Аннотация  PDF (Rus)  похожие документы
Б. Н. Мишанькин, О. В. Дуванова, Л. В. Романова, Е. С. Шипко, А. С. Водопьянов
"... protein of the OmpT outer membranes, with the molar mass of approximately 40 kDa. Synthesis of porin ..."
 
№ 3(109) Некоторые биохимические различия между производственными штаммами-продуцентами холерной химической вакцины Аннотация  PDF (Rus)  похожие документы
И. А. Кузьмиченко, О. В. Громова, М. Н. Киреев, Н. И. Белякова
"... . cholerae M41 Ogawa productive strains. The differences are in the protein content in culture liquid ..."
 
№ 3 (2014) Сравнительная оценка потенциальных белковых основ микробиологических сред Аннотация  PDF (Rus)  похожие документы
Ю. С. Ковтун, А. А. Курилова, Т. В. Таран, Л. С. Катунина, Н. В. Чурикова
"... of protein-containing products, both phytogenous and zoogenous, as nutrient base for microbiological media ..."
 
№ 3 (2018) Особенности первичной структуры цитотоксина MARTX нетоксигенных штаммов Vibrio Cholerae разных серогрупп Аннотация  PDF (Rus)  похожие документы
Е. В. Монахова, И. В. Архангельская, Р. В. Писанов, С. В. Титова
"... by multiple alleles. AlignX-analysis of their deduced products divided 32 proteins into 3 separate clusters ..."
 
№ 2(96) Фенотипические свойства мутантов патогенных Burkholderia, резистентных к фторхинолонам и цефалоспоринам Аннотация  PDF (Rus)  похожие документы
Е. В. Калинкина, Н. П. Агеева, О. А. Меринова, Д. А. Лобойко, Д. В. Викторов, Л. К. Меринова
"... membrane channels. Mutant strains differ in production of extracellular enzymes (proteases, lecithinase ..."
 
№ 1(107) Влияние противочумной вакцинации на функциональную активность клеток врожденного иммунитета человека Аннотация  PDF (Rus)  похожие документы
А. Л. Кравцов, Т. П. Шмелькова, Т. Н. Щуковская
"... proteases from granules on the cells' surface and into the extracellular space. Using flow cytofluorimetry ..."
 
№ 3 (2013) Исторические и современные представления о проблеме специфической профилактики чумы Аннотация  PDF (Rus)  похожие документы
С. А. Бугоркова, З. Л. Девдариани, Т. Н. Щуковская, В. В. Кутырев
"... . 17. Caulfield A.J., Lathem W.W. Substrates of the plasmino- gen activator protease of Yersinia pestis ..."
 
№ 3 (2016) Пути оптимизации синтеза олигонуклеотидов при производстве препаратов для генной диагностики особо опасных инфекционных болезней Аннотация  PDF (Rus)  похожие документы
А. В. Степанов, Н. В. Майоров, Н. А. Осина, А. К. Никифоров
"... Objective of the study is to investigate the impact of activator, oxidize, and unblocking solution ..."
 
№ 1 (2016) Применение 2D-электрофореза для получения «белковых портретов» лизатов бактериальных культур возбудителей особо опасных инфекций Аннотация  PDF (Rus)  похожие документы
Т. А. Полунина, Ю. С. Варшавская, С. П. Заднова, Я. М. Краснов
"... Objective of the study is to deploy 2-D electrophoresis for the construction of lysate “protein ..."
 
№ 3(101) Выявление в природных популяциях холерного вибриона клонов с различной экспрессией факторов вирулентности и персистенции и их фенотипический анализ Аннотация  PDF (Rus)  похожие документы
С. П. Заднова, Л. Ф. Ливанова, Ю. В. Лозовский, Н. И. Смирнова
"... , cholera toxin, hemolysine, soluble hemagglutinin/protease and altered mobility. One of the external ..."
 
№ 4 (2015) Разработка алгоритма идентификации культур возбудителя бруцеллеза методом MALDI-TOF масс-спектрометрии Аннотация  PDF (Rus)  похожие документы
Д. В. Ульшина, Д. А. Ковалев, О. В. Бобрышева, Г. И. Лямкин, А. А. Худолеев, Ю. В. Сирица, А. Н. Куличенко
"... Given are the results of direct protein profiling of brucella strain collection using matrix laser ..."
 
№ 3(105) Роль внеклеточного экзополисахарида в адаптации возбудителя холеры во внешней среде Аннотация  PDF (Rus)  похожие документы
С. П. Заднова, Н. И. Смирнова
"... pathogenicity factors (cholera toxin, soluble hemagglutinin/protease, motility). The data received suggest ..."
 
№ 3 (2019) Биопленка Vibrio cholerae: механизмы, регулирующие образование, и сигналы внешней среды, способствующие ее формированию Аннотация  PDF (Rus)  похожие документы
Н. А. Плеханов, С. П. Заднова, А. А. Крицкий
"... activators, repressors, alternative sigma-factors, regulatory RNA, and a range of signal molecules. The role ..."
 
№ 2 (2017) ВЛИЯНИЕ ДЕЛЕЦИИ ПРОФАГА CTXΦ НА ИЗМЕНЕНИЕ ФЕНОТИПИЧЕСКИХ СВОЙСТВ VIBRIO CHOLERAE БИОВАРА ЭЛЬ ТОР, СВЯЗАННЫХ С ВИРУЛЕНТНОСТЬЮ И ПЕРСИСТЕНТНОСТЬЮ Аннотация  PDF (Rus)  похожие документы
Е. Ю. Щелканова, Е. Ю. Агафонова, Л. Ф. Ливанова, Д. А. Агафонов, Ю. В. Лозовский, Н. И. Смирнова
"... properties associated with virulence (colonizing ability, production of soluble hemagglutinin/protease ..."
 
№ 4 (2016) Сравнительный MLVA-анализ штаммов Vibrio cholerae классического биовара, выделенных в России и за рубежом Аннотация  PDF (Rus)  похожие документы
Н. Б. Челдышова, А. А. Крицкий, Ю. В. Лозовский, Н. П. Гусева
"... , and VCA0238. Nutrient requirement and soluble hemagglutinin/protease production was established using ..."
 
№ 4(98) Получение моноклональных антител к белкам наружной мембраны Burkholderia pseudomallei штамма С-141 Аннотация  PDF (Rus)  похожие документы
С. С. Ветчинин, П. Х. Копылов, Н. В. Киселева, А. М. Баранов, Е. В. Баранова, Е. В. Галкина, А. И. Борзилов, И. Я. Калачев
"... proteins with Mr 29 kDa (p29) and 45 kDa (p45). Monoclonal antibodies from culture supernatant fluids of 4F ..."
 
№ 2(100) Бактерицидная активность полиморфно-ядерных лейкоцитов крови белых мышей, привитых против чумы, и в различных схемах инфицирования чумной инфекцией Аннотация  PDF (Rus)  похожие документы
Д.А. Будыка, Н.В. Абзаева, С.М. Руднев, Г.Ф. Иванова, А.А. Фисун, С.Е. Гостищева, А.И. Бондаренко
"... Investigated was dynamics of germicidal activity factors (cationic proteins and myeloperoxidase ..."
 
№ 2(100) Структурно-функциональная характеристика основных антигенов Francisella tularensis Аннотация  PDF (Rus)  похожие документы
Е.М. Кузнецова, И.А. Шепелёв, О.А. Волох
 
№ 4(106) Получение и иммунологическая характериcтика рекомбинантных белков VP40 и NP филовирусов Аннотация  PDF (Rus)  похожие документы
А. В. Иванова, Е. И. Казачинская, А. В. Качко, Е. Л. Субботина, А. В. Сорокин, И. А. Разумов, С. В. Нетёсов, В. Б. Локтев
"... Full-size genes coding matrix proteins VP40 of Ebola virus (VE) and Marburg virus (VM ..."
 
№ 1(111) Факторы, участвующие в модулировании механизмов иммунной защиты легких при пневмонии Аннотация  PDF (Rus)  похожие документы
А. Н. Микеров
"... during pneumonia. Considered is the role of protein A (SP-A) in provision of lungs resistance ..."
 
№ 2 (2016) Адъювантные технологии в создании современных вакцин Аннотация  PDF (Rus)  похожие документы
А. П. Семакова, Н. И. Микшис
"... -competent cell localization, but also acting as immediate immune activators, are at various stages of trials ..."
 
№ 3 (2015) Моноклональные антитела и рекомбинантные белки для иммунодиагностики болезни, вызванной вирусом Эбола Аннотация  PDF (Rus)  похожие документы
Е. И. Казачинская, Ю. В. Никонорова, В. Б. Локтев
"... antibodies (MCA), specific to structural viral proteins NP, VP40, and VP35; recombinant proteins NP, VP40 ..."
 
№ 4(98) Продукция белков S-слоя разными штаммами Bacillus anthracis Аннотация  PDF (Rus)  похожие документы
И. А. Баркова, В. В. Алексеев, А. В. Липницкий, А. М. Барков, Л. В. Буханцова
"... Investigated were antigenic properties of proteins produced by B. anthracis strains STI (рХО1+, рХО ..."
 
№ 4 (2017) Конструирование рекомбинантного штамма Escherichia coli продуцента основной субъединицы токсин-корегулируемых пилей адгезии TcpA Vibrio cholerae биовара Эль Тор Аннотация  PDF (Rus)  похожие документы
Е. В. Клавдиенко, И. В. Тучков, Т. А. Полунина, Н. П. Гусева, Н. И. Смирнова
"... Objective of the study is to construct recombinant E. coli strain – producer of TcpA protein ..."
 
№ 2(96) Влияние биогенного амина серотонина на рост и профиль белков чумного микроба в условиях культивирования на плотных питательных средах Аннотация  PDF (Rus)  похожие документы
Т. Н. Щуковская, С. Н. Клюева, А. Л. Кравцов, О. А. Волох, Ю. А. Алешина, В. В. Кутырев
 
№ 3(105) Получение поликлональных антител к белкам S-слоя B. anthracis и изучение их специфичности в иммуноферментном анализе Аннотация  PDF (Rus)  похожие документы
А. Ю. Гончарова, Н. И. Микшис, О. М. Кудрявцева, М. Ф. Болотникова, Л. В. Новикова, Г. Г. Красичков, Т. В. Аленкина, Ю. А. Попов
"... Purified preparations of B. anthracis S-layer proteins - Sap and EA1 were obtained. Developed ..."
 
№ 3(109) Изучение влияния УФ-облучения и воздействия налидиксовой кислоты на индукцию RecA-белка в клетках Francisella tularensis 15/10 Аннотация  PDF (Rus)  похожие документы
А. А. Лапин, Т. Б. Кравченко, А. Н. Мокриевич, Г. М. Вахрамеева, Т. И. Комбарова, И. А. Дятлов, В. М. Павлов
"... Studied is the UV irradiation and nalidicsic acid effect on the RecA-protein synthesis ..."
 
№ 2 (2017) ПРИМЕНЕНИЕ 2D-ЭЛЕКТРОФОРЕЗА ДЛЯ ПОЛУЧЕНИЯ БЕЛКОВОГО СПЕКТРА ФРАКЦИЙ ЭКЗОПРОТЕИНОВ ВОЗБУДИТЕЛЕЙ ЧУМЫ И ХОЛЕРЫ Аннотация  PDF (Rus)  похожие документы
Т. А. Полунина, С. П. Заднова, Я. М. Краснов
"... Objective of the study is to apply 2D-electrophoresis for imaging protein spectrum of exoprotein ..."
 
№ 4 (2016) Сравнительная оценка белковых гидролизатов при разработке на их основе питательной среды для культивирования бруцелл Аннотация  PDF (Rus)  похожие документы
Ю. С. Ковтун, А. А. Курилова, Л. С. Катунина, Е. И. Василенко
"... hydrolysates of protein-containing products, both phytogenous and zoogenous, as regards Brucella test strains ..."
 
№ 3 (2017) ИЗУЧЕНИЕ ДИАГНОСТИЧЕСКИХ ВОЗМОЖНОСТЕЙ МОНОКЛОНАЛЬНЫХ АНТИТЕЛ, СПЕЦИФИЧНЫХ К МЕМБРАННОМУ БЕЛКУ ВОЗБУДИТЕЛЯ ХОЛЕРЫ, В ИММУНОФЕРМЕНТНОМ АНАЛИЗЕ Аннотация  PDF (Rus)  похожие документы
В. В. Евдокимова, Л. П. Алексеева, В. П. Зюзина, О. Ф. Кретенчук, М. Э. Яговкин
"... was the hybrid H2F6 clone, which synthesized monoclonal antibodies specific to the outer membrane protein ..."
 
№ 4 (2019) Получение штамма Yersinia pestis, продуцирующего флуоресцентный белок GFP, и перспективы его использования Аннотация  PDF (Rus)  похожие документы
Л. М. Куклева, И. В. Тучков, Е. Г. Оглодин, З. Л. Девдариани, О. А. Морозов, О. С. Кузнецов, В. Г. Германчук, Г. А. Ерошенко
"... protein GFP and analysis of the prospects of its usage for investigation of interaction of the agent ..."
 
№ 4 (2019) Белки вакцинного штамма чумного микроба (Yersinia pestis EV НИИЭГ) с потенциальными свойствами аллергенов Аннотация  PDF (Rus)  похожие документы
В. В. Сутягин, Г. Г. Ковалёва
"... Objective of the study was the search for proteins of the vaccine strain Yersinia pestis EV NIIEG ..."
 
№ 1(95) Конструирование штамма Vibrio cholerae биовара эльтор гиперпродуцента холерного токсина II типа и определение оптимальных условий для продукции этого белка Аннотация  PDF (Rus)  похожие документы
А. А. Горяев, Е. Ю. Щелканова, Ю. В. Лозовский, И. В. Тучков, Н. И. Смирнова
"... of this protein by MAK757clones chr::Tn5-Mob (Km') Tox++. A single clone with the highest cholera toxin ..."
 
№ 4 (2013) Стратегия вирулентности холерных вибрионов и пути ее реализации (обзор) Аннотация  PDF (Rus)  похожие документы
Е. В. Монахова
"... активатор AC, которым обладают холерные вибрионы. Другим «претендентом» на эту роль является описанный ..."
 
№ 4 (2015) Структурно-функциональный анализ криптических плазмид штаммов Yersinia pestis из двух природных очагов чумы России Аннотация  PDF (Rus)  похожие документы
Е. Г. Оглодин, Г. А. Ерошенко, Л. М. Куклева, Г. Н. Одиноков, Н. П. Гусева, С. А. Бугоркова, В. В. Кутырев
"... classified as phage proteins. Hence, it is inferred that pTP33 is a ring genome of phage. It also has two ..."
 
№ 2 (2017) РОЛЬ МАЛЫХ РНК В КОНТРОЛЕ ЭКСПРЕССИИ ГЕНОВ, ВОВЛЕЧЕННЫХ В РЕАЛИЗАЦИЮ ПАТОГЕННОСТИ VIBRIO CHOLERAЕ Аннотация  PDF (Rus)  похожие документы
Р. В. Писанов, А. С. Водопьянов, Д. И. Симакова
"... claster of highly structured single-stranded RNAs which usually would not be translated into proteins ..."
 
№ 2 (2015) Особенности структуры генома токсигенного штамма Vibrio cholerae El Tor Инаба, выделенного в 2014 г. из открытого водоема в Ростове-на-Дону Аннотация  PDF (Rus)  похожие документы
Р. В. Писанов, М. И. Ежова, Е. В. Монахова, А. В. Черкасов, Я. М. Краснов, А. С. Водопьянов, Т. А. Кульшань, Л. Ф. Ливанова, С. А. Портенко, А. С. Абдрашитова, В. Д. Кругликов, С. В. Титова
"... hypothetical protein 55 CAACGCAGAAGTGAAAGGCTCT GTGCTTGCATACGGCTTGATG VC0984 cholera toxin transcriptional ..."
 
№ 3 (2015) Молекулярные механизмы проникновения вируса Эбола в пермиссивные клетки Аннотация  PDF (Rus)  похожие документы
Т. Е. Сизикова, В. Н. Лебедев, В. Б. Пантюхов, С. В. Борисевич
"... a series of cellular protein interactions and molecular mechanisms, some of which are unique to filoviruses ..."
 
№ 2 (2016) Холерные вибрионы неО1/неО139 серогрупп в этиологии острых кишечных инфекций: современная ситуация в России и в мире Аннотация  PDF (Rus)  похожие документы
Е. В. Монахова, И. В. Архангельская
"... токсин – активатор гуанилат- циклазы, вызывающий развитие тяжелой диареи за счет повышения уровня цГМФ ..."
 
№ 2 (2016) Характеристика молекулярно-генетических свойств штаммов возбудителя чумы, перспективных для использования в учебном процессе Аннотация  PDF (Rus)  похожие документы
Е. В. Сазанова, В. Е. Куклев, Т. А. Малюкова, Л. М. Куклева, А. Н. Малахаева, Н. И. Вахрушина
"... специфичных для возбудителя чумы белков: бактериоцина – пести- цина и активатора плазминогена. Активатор плаз ..."
 
№ 2(112) Особенности образования антител у лабораторных животных, иммунизированных препаратом сибиреязвенного протективного антигена, рекомбинантным или вакцинным штаммами Bacillus anthracis Аннотация  PDF (Rus)  похожие документы
П. Ю. Попова, Н. И. Микшис, А. Ю. Гончарова, Т. Н. Каштанова, Ю. А. Попов
"... protein preparation in a dose of 50 mcg induces production of specific antibodies in titers higher than ..."
 
№ 2 (2019) Рекомбинантный штамм Escherichia coli с повышенной продукцией нейраминидазы Vibrio cholerae Аннотация  PDF (Rus)  похожие документы
Е. В. Монахова, Г. В. Демидова, Р. В. Писанов, О. В. Дуванова, Б. Н. Мишанькин
"... by means of conventional methods, performance of recombinants and localization of the required protein ..."
 
№ 2 (2017) МОЛЕКУЛЯРНО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РЕПРОДУКЦИИ АРЕНАВИРУСОВ В ЧУВСТВИТЕЛЬНЫХ КЛЕТКАХ Аннотация  PDF (Rus)  похожие документы
Т. Е. Сизикова, В. Н. Лебедев, В. Б. Пантюхов, А. Ф. Андрус, С. В. Борисевич
"... studies indicate that cellular entry of arenaviruses requires a series of cellular protein interaction ..."
 
№ 2 (2018) Адгезины возбудителя чумы Аннотация  PDF (Rus)  похожие документы
Л. М. Куклева
"... . The presence of adhesines ensures translocation of effector proteins into target cells of mammalians ..."
 
№ 4 (2013) Холерные вибрионы О1 серогруппы, выделенные из водных объектов Ростова-на-Дону в ходе мониторинга в 2008–2012 Аннотация  PDF (Rus)  похожие документы
М. И. Ежова, В. Д. Кругликов, А. С. Водопьянов, С. О. Водопьянов, И. С. Шестиалтынова, И. П. Олейников, Н. Б. Непомнящая, О. А. Подойницына
"... нейраминидазы; маннозочув- ствительные пили адгезии (mshA); гемагглютинин/ протеаза (HA/P); цитотонический ..."
 
№ 3 (2014) Новый способ получения липополисахарида возбудителя чумы Аннотация  PDF (Rus)  похожие документы
Т. А. Полунина, Н. П. Гусева, И. А. Кузьмиченко, З. Л. Девдариани, С. П. Заднова, А. В. Степанов, М. Н. Киреев
"... , использование ингибитора протеаз ФМСФ негатив- но влияло на внесенный протеолитический фермент, однако ..."
 
1 - 50 из 121 результатов 1 2 3 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)